version
PlantPromoterDB promoter information of AT4G20360

Summary of Gene (AT4G20360)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G20360  TAIR      NCBI 
Gene model AT4G20360  
Description ARABIDOPSIS RAB GTPASE HOMOLOG E1B (ATRABE1B); FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; INVOLVED IN: peptidyl-cysteine S-nitrosylation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor Tu, putative / EF-Tu, putative (TAIR:AT4G02930.1); Has 60789 Blast hits to 60738 proteins in 12836 species: Archae - 775; Bacteria - 22875; Metazoa - 13447; Fungi - 6921; Plants - 1294; Viruses - 5; Other Eukaryotes - 15472 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 10989036-10990235)

Genome position     
from initiation codon
AT4G20350.1         
AT4G20360.1         
TSS from cDNA
TSS information
AT4G20360                        5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G20360

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+10989952-84

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+10989910-126
TSS cloneCclone+10989948-88
TSS cloneAclone+10989952-84
TSS cloneTclone+10989953-83
TSS cloneTclone+10989969-67
TSS cloneTclone+10989970-66
TSS cloneCclone+10989971-65
TSS cloneCclone+10989973-63
TSS cloneCclone+10989974-62
TSS cloneAclone+10989975-61
TSS cloneGclone+10990015-21

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCT+1098991210989919-124-117
Y PatchTCTTCTCCTTCTC+1098996110989973-75-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCGTTTA+1098976410989772-272-264
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565 GTCGTTTA PPDB Motif  PLACE Motif 
REGGTGACGTGT+1098979710989805-239-231
 AtREG466GTGACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517 TGACGTGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTAAAACGCCACG+1098981210989823-224-213
 AtREG564TAAAACGC     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG508    ACGCCACG PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.