version
PlantPromoterDB promoter information of AT4G21100.1

Summary of Gene (AT4G21100.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G21100  TAIR      NCBI 
Gene model AT4G21100.1  
Description One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase.  
#
#

Overview

Focused view (chromosome 4: 11266309-11265110)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G21100.1                      5'->3' (-)
Promoter sequence







 
AT4G21105.1         
AT4G21105.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G21100.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-11265462-153
TSS clone peakTclone-11265447-138
TSS cloneGclone-11265420-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCT-1126543311265443-124-134
Y PatchCCTCCTCTCTCCC-1126545911265471-150-162
Y PatchTTCTTCTTC-1126547311265481-164-172
Y PatchTTCTTCTT-1126549311265500-184-191
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAACCGGC-1126550311265511-194-202
 AtREG480TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637 GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGGAA-1126554411265554-235-245
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAATTGGGCCGGGCCGAA-1126559211265609-283-300
 AtREG647CAATTGGG           PPDB Motif  PLACE Motif 
 AtREG418 AATTGGGC          PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414   TTGGGCCG        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457    TGGGCCGG      CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG404     GGGCCGGG     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG427          GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCGCAGCGT-1126568611265693-377-384
 AtREG369CGCAGCGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13+11265665AT4G21105.1, AT4G21105.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+11265651AT4G21105.1, AT4G21105.2
TSS cloneCclone+11265652AT4G21105.1, AT4G21105.2
TSS cloneGclone+11265658AT4G21105.1, AT4G21105.2
TSS cloneTclone+11265659AT4G21105.1, AT4G21105.2
TSS cloneTclone+11265661AT4G21105.1, AT4G21105.2
TSS cloneGclone+11265668AT4G21105.1, AT4G21105.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCTCTC+1126569811265709AT4G21105.1, AT4G21105.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCGGTTCA+1126550311265511AT4G21105.1, AT4G21105.2
 AtREG637GCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTTGG+1126554411265554AT4G21105.1, AT4G21105.2
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550   CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGCCCGGCCCAATTG+1126559211265609AT4G21105.1, AT4G21105.2
 AtREG427TTCGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG404     CCCGGCCC     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457      CCGGCCCA    CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414       CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352        GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418         GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG647          CCCAATTG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.