version
PlantPromoterDB promoter information of AT4G21105.2

Summary of Gene (AT4G21105.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G21105  TAIR      NCBI 
Gene model AT4G21105.2  
Description cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 11265273-11266472)

Genome position     
from initiation codon
AT4G21105.1         
TSS from cDNA
TSS information
AT4G21105.2                      5'->3' (+)
Promoter sequence







 
AT4G21100.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G21105.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+11265665-608

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+11265651-622
TSS cloneCclone+11265652-621
TSS cloneGclone+11265658-615
TSS cloneTclone+11265659-614
TSS cloneTclone+11265661-612
TSS cloneGclone+11265668-605

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCTCTC+1126569811265709-575-564
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGTTCA+1126550311265511-770-762
 AtREG637GCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTTGG+1126554411265554-729-719
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550   CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGCCCGGCCCAATTG+1126559211265609-681-664
 AtREG427TTCGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG404     CCCGGCCC     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457      CCGGCCCA    CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414       CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352        GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418         GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG647          CCCAATTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-11265462AT4G21100.1
TSS clone peakTclone-11265447AT4G21100.1
TSS cloneGclone-11265420AT4G21100.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCT-1126543311265443AT4G21100.1
Y PatchCCTCCTCTCTCCC-1126545911265471AT4G21100.1
Y PatchTTCTTCTTC-1126547311265481AT4G21100.1
Y PatchTTCTTCTT-1126549311265500AT4G21100.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGAACCGGC-1126550311265511AT4G21100.1
 AtREG480TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637 GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGGAA-1126554411265554AT4G21100.1
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAATTGGGCCGGGCCGAA-1126559211265609AT4G21100.1
 AtREG647CAATTGGG           PPDB Motif  PLACE Motif 
 AtREG418 AATTGGGC          PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414   TTGGGCCG        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457    TGGGCCGG      CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG404     GGGCCGGG     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG427          GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCGCAGCGT-1126568611265693AT4G21100.1
 AtREG369CGCAGCGT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.