version
PlantPromoterDB promoter information of AT4G22260.1

Summary of Gene (AT4G22260.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G22260  TAIR      NCBI 
Gene model AT4G22260.1  
Description Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues.  
#
#

Overview

Focused view (chromosome 4: 11773350-11772151)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G22260.1                      5'->3' (-)
Promoter sequence








 
AT4G22270.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G22260.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-11772484-134

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-11772496-146
TSS cloneAclone-11772495-145
TSS cloneTclone-11772460-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCT-1177244811772457-98-107
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGGTCGG-1177258011772589-230-239
 AtREG593CCCGGGTC   PPDB MotifGGGACCC  PLACE Motif 
 AtREG494 CCGGGTCG  PPDB Motif  PLACE Motif 
 AtREG375  CGGGTCGG PPDB MotifCCGAC  PLACE MotifCCGAC 
REGCTAAGCCCAATAAG-1177259411772607-244-257
 AtREG634CTAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355    GCCCAATA   PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA  PPDB MotifGCCCA  PLACE Motif 
 AtREG611      CCAATAAG PPDB Motif  PLACE Motif 
REGGGGCCTTTT-1177262611772634-276-284
 AtREG359GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459 GGCCTTTT PPDB Motif  PLACE Motif 
REGACACGTCAT-1177275811772766-408-416
 AtREG517ACACGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG483 CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+11773328AT4G22270.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCTCT+1177334311773350AT4G22270.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.