version
PlantPromoterDB promoter information of AT4G24370

Summary of Gene (AT4G24370)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G24370  TAIR      NCBI 
Gene model AT4G24370  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 12613102-12611903)

Genome position     
from initiation codon
AT4G24370.1         
AT4G24390.1         
TSS from cDNA
TSS information
AT4G24370                        5'->3' (-)
Promoter sequence






 
AT4G24380.1         
AT4G24380.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G24370

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-12612116-14

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-12612134-32
TSS cloneTclone-12612126-24
TSS cloneAclone-12612116-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAAACCGGTTTT-1261216912612181-67-79
 AtREG511CTAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542     CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAAACGACATCG-1261222712612238-125-136
 AtREG576GAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGCTAAACCGCGT-1261224112612251-139-149
 AtREG511CTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG441   AACCGCGTDrought PPDB Motif  PLACE Motif 
REGCTTATTGGGCCAA-1261235612612368-254-266
 AtREG611CTTATTGG      PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352   ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420    TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484     TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGGGCCGAT-1261240112612408-299-306
 AtREG555GGGCCGAT PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA21+12612535AT4G24380.1, AT4G24380.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+12612535AT4G24380.1, AT4G24380.2
TSS cloneAclone+12612537AT4G24380.1, AT4G24380.2
TSS cloneTclone+12612538AT4G24380.1, AT4G24380.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTTATAAAAA+1261250212612511AT4G24380.1, AT4G24380.2
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGCGGTTTAG+1261224112612251AT4G24380.1, AT4G24380.2
 AtREG441ACGCGGTT   Drought PPDB Motif  PLACE Motif 
 AtREG511   CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGGCCCAATAAG+1261235612612368AT4G24380.1, AT4G24380.2
 AtREG484TTGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355   GCCCAATA   PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA  PPDB MotifGCCCA  PLACE Motif 
 AtREG611     CCAATAAG PPDB Motif  PLACE Motif 
REGATCGGCCC+1261240112612408AT4G24380.1, AT4G24380.2
 AtREG555ATCGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.