version
PlantPromoterDB promoter information of AT4G25500.1

Summary of Gene (AT4G25500.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G25500  TAIR      NCBI 
Gene model AT4G25500.1  
Description encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.  
#
#

Overview

Focused view (chromosome 4: 13024168-13025367)

Genome position     
from initiation codon
AT4G25500.3         
TSS from cDNA
TSS information
AT4G25500.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G25500.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+13024577-591

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+13024598-570
TSS cloneGclone+13024599-569
TSS cloneAclone+13024604-564
TSS cloneTclone+13024609-559

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTT+1302455413024561-614-607
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTTGGGCTTC+1302439013024400-778-768
 AtREG543TGTTGGGC    PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTATAGGCCCAATA+1302441813024430-750-738
 AtREG487TATAGGCC      PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAA+1302448013024487-688-681
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.