version
PlantPromoterDB promoter information of AT4G25650.1

Summary of Gene (AT4G25650.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G25650  TAIR      NCBI 
Gene model AT4G25650.1  
Description Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment.  
#
#

Overview

Focused view (chromosome 4: 13084153-13082954)

Genome position     
from initiation codon
AT4G25650.2         
TSS from cDNA
TSS information
AT4G25650.1                      5'->3' (-)
Promoter sequence





 
AT4G25660.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G25650.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-13083201-48
TSS cloneTclone-13083197-44
TSS clone peakGclone-13083189-36
TSS cloneAclone-13083166-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATAAATT-1308322413083232-71-79
Y PatchCGTCTCTC-1308317813083185-25-32
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGAACCG-1308323813083245-85-92
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAACCGGTTTAG-1308330713083319-154-166
 AtREG501TTAACCGG      PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT     PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG436   ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412    CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511     CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13+13083441AT4G25660.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+13083439AT4G25660.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCAACGGTTCAA+1308323213083245AT4G25660.1
 AtREG586ATCCAACG       PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG      PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG640      CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAACCGGTTAA+1308330713083319AT4G25660.1
 AtREG511CTAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503    ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501     CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.