version
PlantPromoterDB promoter information of AT4G25740.2

Summary of Gene (AT4G25740.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G25740  TAIR      NCBI 
Gene model AT4G25740.2  
Description 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 13109751-13108552)

Genome position     
from initiation codon
AT4G25740.1         
TSS from cDNA
TSS information
AT4G25740.2                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G25740.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC15-13108814-63

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-13108813-62
TSS cloneTclone-13108812-61
TSS cloneTclone-13108810-59
TSS cloneGclone-13108798-47
TSS cloneCclone-13108797-46
TSS cloneGclone-13108787-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATATAAT-1310884113108850-90-99
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGCCCAATAAAAGCCCAAAT-1310885513108876-104-125
 AtREG609TCAGCCCA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA            PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA           PPDB MotifGCCCA  PLACE Motif 
 AtREG549         TAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409          AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376           AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407            AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469             AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421              GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAAGGCC-1310890513108912-154-161
 AtREG467TAAAGGCC PPDB Motif  PLACE Motif 
REGTAACCGGAC-1310891713108925-166-174
 AtREG621TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG573 AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGTTAA-1310893113108941-180-190
 AtREG528GAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503  ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501   CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.