version
PlantPromoterDB promoter information of AT4G26510

Summary of Gene (AT4G26510)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G26510  TAIR      NCBI 
Gene model AT4G26510  
Description ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative (TAIR:AT1G55810.3); Has 5945 Blast hits to 5938 proteins in 1378 species: Archae - 124; Bacteria - 3772; Metazoa - 440; Fungi - 309; Plants - 350; Viruses - 2; Other Eukaryotes - 948 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 13383503-13384702)

Genome position     
from initiation codon
AT4G26510.1         
AT4G26510.2         
TSS from cDNA
TSS information
AT4G26510                        5'->3' (+)
Promoter sequence


 
AT4G26500.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G26510

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+13383843-660

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+13384062-441

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCC+1338382613383833-677-670
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAACCGG+1338368013383688-823-815
 AtREG473TTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-13383637AT4G26500.1
TSS clone peakTclone-13383605AT4G26500.1
TSS cloneAclone-13383601AT4G26500.1
TSS cloneGclone-13383600AT4G26500.1
TSS cloneGclone-13383591AT4G26500.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC-1338359213383599AT4G26500.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGGTTTAA-1338368013383688AT4G26500.1
 AtREG412CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.