version
PlantPromoterDB promoter information of AT4G26740.1

Summary of Gene (AT4G26740.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G26740  TAIR      NCBI 
Gene model AT4G26740.1  
Description Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27.  
#
#

Overview

Focused view (chromosome 4: 13476278-13475079)

Genome position     
from initiation codon
AT4G26750.1         
TSS from cDNA
TSS information
AT4G26740.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G26740.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-13475328-50
TSS cloneAclone-13475322-44
TSS clone peakCclone-13475308-30
TSS cloneCclone-13475306-28
TSS cloneAclone-13475292-14

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGCCACG-1347538213475389-104-111
 AtREG560CCGCCACGABA PPDB MotifCCGAC  PLACE MotifGCCAC 
REGCGGCGCGTG-1347539513475403-117-125
 AtREG538CGGCGCGT  PPDB MotifACGCGC  PLACE Motif 
 AtREG486 GGCGCGTG PPDB MotifACGCGC  PLACE Motif 
REGACGTGTCT-1347549213475499-214-221
 AtREG470ACGTGTCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGGTTGGGCCTATATAAAAGCCCATAGAGGCCC-1347555413475584-276-306
 AtREG449GTTGGGCC                        PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356 TTGGGCCT                       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358  TGGGCCTA                      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362   GGGCCTAT                     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG487    GGCCTATA                    PPDB Motif  PLACE Motif 
 AtREG549            TAAAAGCC            PPDB Motif  PLACE Motif 
 AtREG409             AAAAGCCC           PPDB MotifGCCCA  PLACE Motif 
 AtREG376              AAAGCCCA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378               AAGCCCAT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477                AGCCCATA        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG411                       AGAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.