version
PlantPromoterDB promoter information of AT4G26750.1

Summary of Gene (AT4G26750.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G26750  TAIR      NCBI 
Gene model AT4G26750.1  
Description hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF605 (InterPro:IPR006745); BEST Arabidopsis thaliana protein match is: ATGSL11 (glucan synthase-like 11); 1,3-beta-glucan synthase/ transferase, transferring glycosyl groups (TAIR:AT3G59100.1); Has 27093 Blast hits to 16071 proteins in 790 species: Archae - 16; Bacteria - 1458; Metazoa - 10297; Fungi - 5609; Plants - 4452; Viruses - 743; Other Eukaryotes - 4518 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 13479382-13478183)

Genome position     
from initiation codon
AT4G26760.1         
TSS from cDNA
TSS information
AT4G26750.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G26750.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-13478432-50

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-13478437-55
TSS cloneTclone-13478436-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTCGTTTC-1347849013478500-108-118
 AtREG431GACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG493 ACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG415  CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576   GTCGTTTC PPDB Motif  PLACE Motif 
REGTTTTGGGC-1347856013478567-178-185
 AtREG529TTTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGC-1347859213478599-210-217
 AtREG421ATTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAA-1347862613478633-244-251
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGACCGGTTTAG-1347864013478650-258-268
 AtREG552GACCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511   CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.