version
PlantPromoterDB promoter information of AT4G26970.1

Summary of Gene (AT4G26970.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G26970  TAIR      NCBI 
Gene model AT4G26970.1  
Description aconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 13542077-13543276)

Genome position     
from initiation codon
AT4G26965.1         
AT4G26965.2         
TSS from cDNA
TSS information
AT4G26970.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G26970.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+13542891-186
TSS peakG4+13543007-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+13542887-190
TSS cloneTclone+13542890-187
TSS cloneGclone+13542922-155

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTGTATAT+1354285213542859-225-218
Y PatchTCTCTTCTCC+1354292913542938-148-139
Y PatchTCTTCTTCC+1354297313542981-104-96
Y PatchCCTTCTTCCTTCCTCT+1354302013543035-57-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAACGGTC+1354276013542767-317-310
 AtREG553CAACGGTCAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGATCCAACGGTTAAA+1354280913542822-268-255
 AtREG586ATCCAACG       PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG      PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG645      CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCTGACGTGGCCTTGGGCCAT+1354283313542852-244-225
 AtREG440CTGACGTG            ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG            PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388  GACGTGGC           PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG505          CTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420           TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437            TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.