version
PlantPromoterDB promoter information of AT4G27230.1

Summary of Gene (AT4G27230.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G27230  TAIR      NCBI 
Gene model AT4G27230.1  
Description Encodes HTA2, a histone H2A protein.  
#
#

Overview

Focused view (chromosome 4: 13639325-13638126)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G27230.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G27230.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-13638382-57

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-13638415-90
TSS cloneTclone-13638414-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCT-1363836213638370-37-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGACGGT-1363851113638519-186-194
 AtREG622TCTGACGG  PPDB Motif  PLACE Motif 
 AtREG625 CTGACGGT PPDB Motif  PLACE Motif 
REGCAAGCCCAATATAGCCCATATA-1363860913638630-284-305
 AtREG525CAAGCCCA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA            PPDB MotifGCCCA  PLACE Motif 
 AtREG509    CCCAATAT           PPDB Motif  PLACE Motif 
 AtREG581           TAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477            AGCCCATA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432             GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620              CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCA-1363866713638676-342-351
 AtREG529TTTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.