version
PlantPromoterDB promoter information of AT4G27585.1

Summary of Gene (AT4G27585.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G27585  TAIR      NCBI 
Gene model AT4G27585.1  
Description band 7 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid, membrane; EXPRESSED IN: callus, leaf; CONTAINS InterPro DOMAIN/s: Stomatin (InterPro:IPR001972), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT5G54100.1); Has 7621 Blast hits to 7607 proteins in 1311 species: Archae - 148; Bacteria - 4066; Metazoa - 810; Fungi - 128; Plants - 171; Viruses - 3; Other Eukaryotes - 2295 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 13770832-13769633)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G27585.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G27585.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-13769862-30

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-13769961-129
TSS cloneAclone-13769862-30
TSS cloneCclone-13769861-29
TSS cloneTclone-13769859-27

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATTATAA-1376989313769900-61-68
Y PatchTTCCTTCTTC-1376986313769872-31-40
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAGCCCAATAA-1376998013769992-148-160
 AtREG365TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.