version
PlantPromoterDB promoter information of AT4G28610.1

Summary of Gene (AT4G28610.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G28610  TAIR      NCBI 
Gene model AT4G28610.1  
Description Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling.  
#
#

Overview

Focused view (chromosome 4: 14135951-14134752)

Genome position     
from initiation codon
AT4G28620.1         
TSS from cDNA
TSS information
AT4G28610.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G28610.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-14135251-300

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-14135259-308
TSS cloneGclone-14135254-303
TSS cloneAclone-14135250-299

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACG-1413530314135311-352-360
 AtREG520AAAACGAC  PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG PPDB Motif  PLACE Motif 
REGTCACGCGCT-1413533014135338-379-387
 AtREG395TCACGCGC  PPDB MotifACGCGC  PLACE Motif 
 AtREG381 CACGCGCT PPDB MotifACGCGC  PLACE Motif 
REGGTCCACGTAG-1413536014135369-409-418
 AtREG513GTCCACGT  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG495  CCACGTAG PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCCCAATTA-1413538314135390-432-439
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAATA-1413539714135407-446-456
 AtREG525CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGTTTGGGCCTTTA-1413548414135495-533-544
 AtREG373TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356 TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353  TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359   GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG467    GGCCTTTA PPDB Motif  PLACE Motif 
REGAAAAAGCC-1413549814135505-547-554
 AtREG589AAAAAGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.