version
PlantPromoterDB promoter information of AT4G31290.1

Summary of Gene (AT4G31290.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G31290  TAIR      NCBI 
Gene model AT4G31290.1  
Description ChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15185851-15187050)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G31290.1                      5'->3' (+)
Promoter sequence









 
AT4G31280.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G31290.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA18+15185997-854
TSS peakA13+15186200-651

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+15185991-860
TSS cloneTclone+15185992-859
TSS cloneTclone+15185995-856

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTCTATAAATG+1518595315185964-898-887
Y PatchCTCTCTCTCT+1518594815185957-903-894
Y PatchCTCTTCTTCC+1518596515185974-886-877
Y PatchCCTCCTCCTC+1518598415185993-867-858
Y PatchTTCTCTTC+1518622815186235-623-616
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCACGTGAC+1518584915185858-1002-993
 AtREG583GTCACGTGAC PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGCGTGGCAT+1518591715185924-934-927
 AtREG448CGTGGCATABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
REGCGGTTCGGT+1518593315185941-918-910
 AtREG456CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 GGTTCGGT PPDB Motif  PLACE Motif 
REGCGAACCGAAACGACGCCGTT+1518610215186121-749-730
 AtREG575CGAACCGA             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG576      GAAACGAC       PPDB Motif  PLACE Motif 
 AtREG415       AAACGACG      PPDB Motif  PLACE Motif 
 AtREG439        AACGACGC     PPDB Motif  PLACE Motif 
 AtREG537         ACGACGCC    PPDB Motif  PLACE Motif 
 AtREG540           GACGCCGT  PPDB Motif  PLACE Motif 
 AtREG497            ACGCCGTT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.