version
PlantPromoterDB promoter information of AT4G31770.1

Summary of Gene (AT4G31770.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G31770  TAIR      NCBI 
Gene model AT4G31770.1  
Description calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15373422-15372223)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G31770.1                      5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G31770.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-15372650-228
TSS peakA8-15372552-130

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-15372595-173
TSS cloneTclone-15372534-112

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTTTCT-1537253015372538-108-116
Y PatchCTCTTCTT-1537255315372560-131-138
Y PatchCTTCTTCTCT-1537256215372571-140-149
Y PatchTTCTTCTTCTTCCTC-1537260915372623-187-201
Y PatchCTCTTCTCTTC-1537266815372678-246-256
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAACGACATCG-1537262915372640-207-218
 AtREG576GAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGGAAACGAC-1537266015372667-238-245
 AtREG576GAAACGAC PPDB Motif  PLACE Motif 
REGCGCGTTTT-1537269115372698-269-276
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTTTGGGCTTTT-1537273015372741-308-319
 AtREG529TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTAGTGGGCTTTTGGGCCTAAC-1537276515372785-343-363
 AtREG532TAGTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG510 AGTGGGCT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518  GTGGGCTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT          PPDB MotifGCCCA  PLACE Motif 
 AtREG529        TTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373         TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356          TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358           TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360            GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG535             GGCCTAAC PPDB Motif  PLACE Motif 
REGTTTAACGG-1537282315372830-401-408
 AtREG610TTTAACGG PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGAATAGGCCC-1537283415372842-412-420
 AtREG424AATAGGCC  PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCCCATTAT-1537287215372879-450-457
 AtREG546CCCATTAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.