version
PlantPromoterDB promoter information of AT4G31810.1

Summary of Gene (AT4G31810.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G31810  TAIR      NCBI 
Gene model AT4G31810.1  
Description enoyl-CoA hydratase/isomerase family protein; FUNCTIONS IN: 3-hydroxyisobutyryl-CoA hydrolase activity, catalytic activity; INVOLVED IN: fatty acid beta-oxidation, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: enoyl-CoA hydratase/isomerase family protein (TAIR:AT3G60510.1); Has 15447 Blast hits to 15442 proteins in 1087 species: Archae - 153; Bacteria - 9368; Metazoa - 927; Fungi - 405; Plants - 335; Viruses - 0; Other Eukaryotes - 4259 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15391290-15390091)

Genome position     
from initiation codon
AT4G31820.1         
TSS from cDNA
TSS information
AT4G31810.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G31810.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-15390317-27

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-15390309-19
TSS cloneAclone-15390308-18
TSS cloneAclone-15390298-8

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCT-1539031115390318-21-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGACGG-1539038115390388-91-98
 AtREG622TCTGACGG PPDB Motif  PLACE Motif 
REGTTGGGCTCA-1539044415390452-154-162
 AtREG533TTGGGCTC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485 TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTGGGCCTTATGGGCTCA-1539045615390474-166-184
 AtREG505CTTGGGCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356 TTGGGCCT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353  TGGGCCTT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351   GGGCCTTA         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425    GGCCTTAT        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG394        TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477         TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485           TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTATGGGCTAA-1539048515390495-195-205
 AtREG394TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581  ATGGGCTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571   TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.