version
PlantPromoterDB promoter information of AT4G31930.1

Summary of Gene (AT4G31930.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G31930  TAIR      NCBI 
Gene model AT4G31930.1  
Description mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15451804-15450605)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G31930.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G31930.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-15450838-34
TSS clone peakGclone-15450836-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAAGCCCAC-1545088815450898-84-94
 AtREG589AAAAAGCC    PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518   AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAAGCCCATTAA-1545092515450936-121-132
 AtREG476GAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGAATTGGGCTTTAA-1545096415450976-160-172
 AtREG418AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545     GGCTTTAA PPDB Motif  PLACE Motif 
REGTAGCCCAT-1545111615451123-312-319
 AtREG581TAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.