version
PlantPromoterDB promoter information of AT4G32260

Summary of Gene (AT4G32260)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G32260  TAIR      NCBI 
Gene model AT4G32260  
Description ATP synthase family; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit B/B', bacterial and chloroplast (InterPro:IPR002146); Has 1542 Blast hits to 1530 proteins in 464 species: Archae - 6; Bacteria - 819; Metazoa - 9; Fungi - 5; Plants - 48; Viruses - 1; Other Eukaryotes - 654 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 15575586-15574387)

Genome position     
from initiation codon
AT4G32260.1         
AT4G32270.1         
AT4G32270.2         
TSS from cDNA
TSS information
AT4G32260                        5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G32260

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA67-15574678-92

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-15574733-147
TSS cloneGclone-15574729-143
TSS cloneCclone-15574724-138
TSS cloneTclone-15574710-124
TSS cloneTclone-15574706-120
TSS cloneTclone-15574704-118
TSS cloneAclone-15574687-101
TSS cloneAclone-15574686-100
TSS cloneTclone-15574683-97
TSS cloneCclone-15574680-94
TSS cloneTclone-15574679-93
TSS cloneAclone-15574678-92
TSS cloneAclone-15574677-91
TSS cloneTclone-15574660-74
TSS cloneCclone-15574658-72
TSS cloneCclone-15574650-64
TSS cloneAclone-15574645-59
TSS cloneCclone-15574636-50
TSS cloneAclone-15574628-42
TSS cloneTclone-15574617-31
TSS cloneGclone-15574611-25
TSS cloneTclone-15574601-15
TSS cloneGclone-15574596-10
TSS cloneTclone-15574591-5
TSS cloneGclone-15574587-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTCTCTCCC-1557465715574671-71-85
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAAACGC-1557477915574786-193-200
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.