version
PlantPromoterDB promoter information of AT4G33520.2

Summary of Gene (AT4G33520.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G33520  TAIR      NCBI 
Gene model AT4G33520.2  
Description Encodes a putative metal-transporting P-type ATPase.  
#
#

Overview

Focused view (chromosome 4: 16116393-16117592)

Genome position     
from initiation codon
AT4G33510.1         
AT4G33510.2         
TSS from cDNA
TSS information
AT4G33520.2                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G33520.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26+16118951-42

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+16118945-48
TSS cloneAclone+16118946-47
TSS cloneAclone+16118947-46
TSS cloneAclone+16118952-41

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGTCACG+1611872916118736-264-257
 AtREG489ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGCCCATTAAG+1611878216118790-211-203
 AtREG396CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604 CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGCACACGTGGAC+1611888416118894-109-99
 AtREG460CACACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382 ACACGTGG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG408  CACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG513   ACGTGGACABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC4+16116460AT4G33510.1, AT4G33510.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+16116432AT4G33510.1, AT4G33510.2
TSS cloneAclone+16116447AT4G33510.1, AT4G33510.2
TSS cloneTclone+16116448AT4G33510.1, AT4G33510.2
TSS cloneAclone+16116462AT4G33510.1, AT4G33510.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTCTTCTCT+1611643316116446AT4G33510.1, AT4G33510.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCCCAATTA-1611640216116411AT4G33500.1
 AtREG402AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418 GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600  CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGTAATTGGGCT+1611640216116411AT4G33510.1, AT4G33510.2
 AtREG600TAATTGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.