version
PlantPromoterDB promoter information of AT4G33690.1

Summary of Gene (AT4G33690.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G33690  TAIR      NCBI 
Gene model AT4G33690.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16174198-16175397)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G33690.1                      5'->3' (+)
Promoter sequence










 
AT4G33680.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G33690.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+16174819-379

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTCT+1617482016174830-378-368
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACGC+1617453616174545-662-653
 AtREG520AAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC PPDB Motif  PLACE Motif 
REGTTCGGTTTGG+1617472616174735-472-463
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550  CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCGGTTTGTTCCGGTTCGGTTT+1617475116174774-447-424
 AtREG561ATCCGGTT                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534          TTCCGGTT       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579           TCCGGTTC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423            CCGGTTCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456             CGGTTCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451              GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556               GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568                TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-16174679AT4G33680.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-16174683AT4G33680.1
TSS cloneGclone-16174675AT4G33680.1
TSS cloneCclone-16174674AT4G33680.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCAAACCGAA-1617472616174735AT4G33680.1
 AtREG550CCAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAACCGGAACAAACCGGAT-1617475116174774AT4G33680.1
 AtREG568AAACCGAA                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC               PPDB Motif  PLACE Motif 
 AtREG456   CCGAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423    CGAACCGG             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579     GAACCGGA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534      AACCGGAA           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496              CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521               AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561                AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGCGTTTT-1617486516174872AT4G33680.1
 AtREG650GGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.