version
PlantPromoterDB promoter information of AT4G33865

Summary of Gene (AT4G33865)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G33865  TAIR      NCBI 
Gene model AT4G33865  
Description 40S ribosomal protein S29 (RPS29C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S14 (InterPro:IPR001209); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S29 (RPS29B) (TAIR:AT3G44010.1); Has 694 Blast hits to 694 proteins in 260 species: Archae - 152; Bacteria - 0; Metazoa - 229; Fungi - 88; Plants - 102; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16235214-16234015)

Genome position     
from initiation codon
AT4G33865.1         
AT4G33870.1         
TSS from cDNA
TSS information
AT4G33865                        5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G33865

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13-16234165-51

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-16234197-83
TSS cloneAclone-16234180-66
TSS cloneTclone-16234169-55
TSS cloneGclone-16234165-51
TSS cloneTclone-16234164-50
TSS cloneTclone-16234162-48
TSS cloneAclone-16234156-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCT-1623415916234166-45-52
Y PatchCTCTCTCTCTC-1623418216234192-68-78
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAGGCCCATATA-1623424016234253-126-139
 AtREG425ATAAGGCC       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364    GGCCCATA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432     GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620      CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGTTTAGGCCCATATA-1623425516234268-141-154
 AtREG430TTTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364    GGCCCATA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432     GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620      CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGGAATGGGCTA-1623428016234289-166-175
 AtREG643GAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581  ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.