version
PlantPromoterDB promoter information of AT4G34450.1

Summary of Gene (AT4G34450.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34450  TAIR      NCBI 
Gene model AT4G34450.1  
Description coatomer gamma-2 subunit, putative / gamma-2 coat protein, putative / gamma-2 COP, putative; FUNCTIONS IN: protein binding, clathrin binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Coatomer, gamma subunit, appendage, Ig-like subdomain (InterPro:IPR013040), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Coatomer, gamma subunit (InterPro:IPR017106), Coatomer, gamma subunit , appendage (InterPro:IPR014863), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin alpha-adaptin/coatomer adaptor, appendage, C-terminal subdomain (InterPro:IPR015873), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G16200.1); Has 1246 Blast hits to 1241 proteins in 162 species: Archae - 0; Bacteria - 2; Metazoa - 606; Fungi - 289; Plants - 90; Viruses - 0; Other Eukaryotes - 259 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16470956-16472155)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G34450.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34450.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+16471874-82

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+16471835-121
TSS cloneTclone+16471863-93
TSS cloneTclone+16471870-86
TSS cloneTclone+16471873-83
TSS cloneGclone+16471874-82
TSS cloneTclone+16471875-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTCTTTCTCC+1647185816471872-98-84
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCTATT+1647162016471627-336-329
 AtREG424GGCCTATT PPDB Motif  PLACE Motif 
REGTATGGGCTATTGGGCCG+1647175316471769-203-187
 AtREG477TATGGGCT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581 ATGGGCTA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584   GGGCTATT       PPDB MotifGCCCA  PLACE Motif 
 AtREG624      CTATTGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG355       TATTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG352        ATTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414         TTGGGCCG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.