version
PlantPromoterDB promoter information of AT4G34660.1

Summary of Gene (AT4G34660.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34660  TAIR      NCBI 
Gene model AT4G34660.1  
Description SH3 domain-containing protein 2 (SH3P2); FUNCTIONS IN: clathrin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: clathrin binding (TAIR:AT4G18060.1); Has 1201 Blast hits to 1169 proteins in 144 species: Archae - 0; Bacteria - 12; Metazoa - 956; Fungi - 47; Plants - 87; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16549294-16548095)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G34660.1                      5'->3' (-)
Promoter sequence








 
AT4G34670.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34660.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG10-16548462-168

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-16548439-145

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGCCCAATAT-1654850916548519-215-225
 AtREG533GAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402 AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355  GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509   CCCAATAT PPDB Motif  PLACE Motif 
REGCAAGCCCAATGGGCTATT-1654852516548542-231-248
 AtREG525CAAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461   GCCCAATG        PPDB MotifGCCCA  PLACE Motif 
 AtREG551      CAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372       AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581        ATGGGCTA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG584          GGGCTATT PPDB MotifGCCCA  PLACE Motif 
REGTCTAGGGT-1654860316548610-309-316
 AtREG658TCTAGGGT PPDB MotifACCCT  PLACE Motif 
REGAAGCCCTA-1654863716548644-343-350
 AtREG651AAGCCCTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG47+16548655AT4G34670.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+16548647AT4G34670.1
TSS cloneTclone+16548649AT4G34670.1
TSS cloneAclone+16548651AT4G34670.1
TSS cloneCclone+16548652AT4G34670.1
TSS cloneTclone+16548653AT4G34670.1
TSS cloneGclone+16548655AT4G34670.1
TSS cloneTclone+16548656AT4G34670.1
TSS cloneTclone+16548657AT4G34670.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATAAATG+1654861116548622AT4G34670.1
Y PatchCTTTCTCTC+1654864216548650AT4G34670.1
Y PatchCTTCTTCTTCTTCCTC+1654866516548680AT4G34670.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATATTGGGCTC+1654850916548519AT4G34670.1
 AtREG509ATATTGGG    PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533   TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAATAGCCCATTGGGCTTG+1654852516548542AT4G34670.1
 AtREG584AATAGCCC           PPDB MotifGCCCA  PLACE Motif 
 AtREG581  TAGCCCAT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551    GCCCATTG       PPDB MotifGCCCA  PLACE Motif 
 AtREG461       CATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402        ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407         TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525          TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGACCCTAGA+1654860316548610AT4G34670.1
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.