version
PlantPromoterDB promoter information of AT4G34710

Summary of Gene (AT4G34710)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34710  TAIR      NCBI 
Gene model AT4G34710  
Description encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1.  
#
#

Overview

Focused view (chromosome 4: 16564950-16563751)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G34710                        5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34710

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA30-16562969-519
TSS peakG5-16562635-185
TSS peakT8-16562461-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-16562969-519
TSS cloneCclone-16562968-518
TSS cloneTclone-16562499-49
TSS cloneTclone-16562472-22

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCCTATATAAGC-1656299616563008-546-558
Y PatchTCTTCTCCT-1656264216562650-192-200
Y PatchCCTTCTCTTCTTCTTCTTCTTC-1656294516562966-495-516
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGCCCAAAT-1656305816563068-608-618
 AtREG437ATGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373  GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGGCCC-1656307016563080-620-630
 AtREG443TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391   ATGGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.