version
PlantPromoterDB promoter information of AT4G34860

Summary of Gene (AT4G34860)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34860  TAIR      NCBI 
Gene model AT4G34860  
Description beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16613019-16611820)

Genome position     
from initiation codon
AT4G34860.1         
AT4G34860.2         
TSS from cDNA
TSS information
AT4G34860                        5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34860

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-16612667-648

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-16612907-888
TSS cloneCclone-16612670-651
TSS cloneGclone-16612623-604

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTCTCTCTCTC-1661266816612683-649-664
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTACACGTGGACCCAC-1661273716612752-718-733
 AtREG562GTACACGT        ABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG453 TACACGTG       ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG382  ACACGTGG      ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG408   CACGTGGA     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG513    ACGTGGAC    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG523        GGACCCAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.