version
PlantPromoterDB promoter information of AT4G34900.1

Summary of Gene (AT4G34900.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G34900  TAIR      NCBI 
Gene model AT4G34900.1  
Description XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 16632306-16631107)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G34900.1                      5'->3' (-)
Promoter sequence










 
AT4G34910.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G34900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-16631327-21
TSS clone peakTclone-16631326-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATTGGGCTTTT-1663143916631451-133-145
 AtREG600TAATTGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCTTA-1663145316631463-147-157
 AtREG394TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATATTGGGCTTATTTTGGGCT-1663147416631494-168-188
 AtREG509ATATTGGG              PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462     GGGCTTAT         PPDB MotifGCCCA  PLACE Motif 
 AtREG529            TTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG469             TTTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+16631533AT4G34910.1
TSS clone peakGclone+16631556AT4G34910.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTCCT+1663159916631608AT4G34910.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAAGCCCAATTA+1663143916631451AT4G34910.1
 AtREG409AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418    GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600     CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATAA+1663145316631463AT4G34910.1
 AtREG426TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAAAATAAGCCCAATAT+1663147416631494AT4G34910.1
 AtREG469AGCCCAAA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529 GCCCAAAA             PPDB MotifGCCCA  PLACE Motif 
 AtREG462        ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426         TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407          AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402           AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355            GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509             CCCAATAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.