version
PlantPromoterDB promoter information of AT4G35440.1

Summary of Gene (AT4G35440.1)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G35440  TAIR      NCBI 
Gene model AT4G35440.1  
Description Enclodes a choride channel protein that is localized to the thlakoid membrane.  
#
#

Overview

Focused view (chromosome 4: 16840345-16839146)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT4G35440.1                      5'->3' (-)
Promoter sequence






 
AT4G35450.1         
AT4G35450.2         
AT4G35450.3         
AT4G35450.4         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G35440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-16839369-24
TSS clone peakTclone-16839368-23
TSS cloneGclone-16839352-7

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCACGTA-1683941616839424-71-79
 AtREG450AGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413 GCCACGTA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGCAAGGCCCAAGCCCAT-1683944416839459-99-114
 AtREG398CAAGGCCC         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505   GGCCCAAG      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG525       CAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378        AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATTGGCCCATATA-1683947316839485-128-140
 AtREG446ATTGGCCC     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG484 TTGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  TGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364   GGCCCATA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432    GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620     CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGGGCCTTTT-1683950816839515-163-170
 AtREG459GGCCTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13+16839687AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS peakA8+16840054AT4G35450.4

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+16839551AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneTclone+16839631AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneTclone+16839633AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneAclone+16839639AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneAclone+16839640AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneAclone+16839687AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneAclone+16839688AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneTclone+16839691AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneCclone+16839695AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneTclone+16839768AT4G35450.3, AT4G35450.4, AT4G35450.2, AT4G35450.1
TSS cloneAclone+16840024AT4G35450.4

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTCTTCTTCCT+1683970816839725AT4G35450.1, AT4G35450.2, AT4G35450.3, AT4G35450.4
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACGTGGCT+1683941616839424AT4G35450.1, AT4G35450.2, AT4G35450.3, AT4G35450.4
 AtREG413TACGTGGC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG450 ACGTGGCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGATGGGCTTGGGCCTTG+1683944416839459AT4G35450.1, AT4G35450.2, AT4G35450.3, AT4G35450.4
 AtREG378ATGGGCTT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525 TGGGCTTG        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG505     CTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356      TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353       TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398        GGGCCTTG PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTATATGGGCCAAT+1683947316839485AT4G35450.1, AT4G35450.2, AT4G35450.3, AT4G35450.4
 AtREG620TATATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364  TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490   ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484    TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446     GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAAAGGCC+1683950816839515AT4G35450.1, AT4G35450.2, AT4G35450.3, AT4G35450.4
 AtREG459AAAAGGCC PPDB Motif  PLACE Motif 
REGCTTAATGG+1683985816839865AT4G35450.4
 AtREG604CTTAATGG PPDB Motif  PLACE MotifTTAATGG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.