version
PlantPromoterDB promoter information of AT4G36400.2

Summary of Gene (AT4G36400.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G36400  TAIR      NCBI 
Gene model AT4G36400.2  
Description FAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 17196265-17197464)

Genome position     
from initiation codon
AT4G36400.1         
TSS from cDNA
TSS information
AT4G36400.2                      5'->3' (+)
Promoter sequence



 
AT4G36390.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G36400.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+17197246-19
TSS clone peakGclone+17197249-16

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAACGCAGCGTTT+1719714117197155-124-110
 AtREG564TAAAACGC        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369     CGCAGCGT   PPDB Motif  PLACE Motif 
 AtREG626       CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTCAGGGGTAA+1719716817197177-97-88
 AtREG595TCAGGGGT  CK PPDB MotifACCCCT  PLACE Motif 
 AtREG642  AGGGGTAA PPDB MotifACCCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-17197094AT4G36390.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-17197131AT4G36390.1
TSS cloneCclone-17197095AT4G36390.1
TSS cloneTclone-17197093AT4G36390.1
TSS cloneGclone-17197091AT4G36390.1
TSS cloneTclone-17197090AT4G36390.1
TSS cloneTclone-17197089AT4G36390.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACGCTGCGTTTTA-1719714117197155AT4G36390.1
 AtREG626AAACGCTG        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369  ACGCTGCG      PPDB Motif  PLACE Motif 
 AtREG564       GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTACCCCTGA-1719716817197177AT4G36390.1
 AtREG642TTACCCCT   PPDB MotifACCCCT  PLACE Motif 
 AtREG595  ACCCCTGACK PPDB MotifACCCCT  PLACE Motif 
REGACGTGACA-1719735317197360AT4G36390.1
 AtREG606ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAAAGTCAA-1719738517197392AT4G36390.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.