version
PlantPromoterDB promoter information of AT4G38930.2

Summary of Gene (AT4G38930.2)

Organism Arabidopsis thaliana  
Chromosome 4  
Locus AT4G38930  TAIR      NCBI 
Gene model AT4G38930.2  
Description ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 4: 18148907-18150106)

Genome position     
from initiation codon
AT4G38920.1         
AT4G38930.1         
TSS from cDNA
TSS information
AT4G38930.2                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT4G38930.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+18149534-373

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+18149534-373

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAAGA+1814950118149511-406-396
Y PatchTTCTTCTTCTC+1814956918149579-338-328
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCATTGGGCT+1814927918149291-628-616
 AtREG372AGCCCATT      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551 GCCCATTG     PPDB MotifGCCCA  PLACE Motif 
 AtREG461    CATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG402     ATTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAAGCCCAAAC+1814930718149317-600-590
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469  AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCAAAGCCCAAA+1814943818149448-469-459
 AtREG559CAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469   AGCCCAAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAAGCCCAAGCCCATAT+1814946318149479-444-428
 AtREG426TAAGCCCA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525      CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378       AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477        AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432         GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.