version
PlantPromoterDB promoter information of AT5G02150

Summary of Gene (AT5G02150)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02150  TAIR      NCBI 
Gene model AT5G02150  
Description binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 427068-425869)

Genome position     
from initiation codon
AT5G02150.1         
AT5G02150.2         
TSS from cDNA
TSS information
AT5G02150                        5'->3' (-)
Promoter sequence











 
AT5G02160.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02150

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-426074-6

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-426079-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCTTCTTCC-426078426092-10-24
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAGGCCCAAAC-426131426143-63-75
 AtREG425ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG474     GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCAATTGGGCCTGTTAAGCCCATTAT-426159426183-91-115
 AtREG647CAATTGGG                  PPDB Motif  PLACE Motif 
 AtREG418 AATTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370    TGGGCCTG              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG433     GGGCCTGT             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG426             TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378              AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372               AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357                GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546                 CCCATTAT PPDB Motif  PLACE Motif 
REGGTAGGCCC-426205426212-137-144
 AtREG435GTAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCGTGACGTGTCAC-426284426296-216-228
 AtREG489CGTGACGT     ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
 AtREG466 GTGACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG481   GACGTGTC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG389    ACGTGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG498     CGTGTCACABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC15+426357AT5G02160.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+426273AT5G02160.1
TSS cloneTclone+426343AT5G02160.1
TSS cloneCclone+426358AT5G02160.1
TSS cloneAclone+426360AT5G02160.1
TSS cloneAclone+426361AT5G02160.1
TSS cloneAclone+426366AT5G02160.1
TSS cloneAclone+426375AT5G02160.1
TSS cloneCclone+426376AT5G02160.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTT+426339426347AT5G02160.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTTTGGGCCTTAT+426131426143AT5G02160.1
 AtREG474GTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425     GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAATGGGCTTAACAGGCCCAATTG+426159426183AT5G02160.1
 AtREG546ATAATGGG                  PPDB Motif  PLACE Motif 
 AtREG357 TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG433            ACAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370             CAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356              AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352               GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418                GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG647                 CCCAATTG PPDB Motif  PLACE Motif 
REGGGGCCTAC+426205426212AT5G02160.1
 AtREG435GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGTGACACGTCACG+426284426296AT5G02160.1
 AtREG498GTGACACG     ABA PPDB Motif  PLACE Motif 
 AtREG389 TGACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG481  GACACGTC   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG517   ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG466    CACGTCAC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG489     ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.