version
PlantPromoterDB promoter information of AT5G02410.1

Summary of Gene (AT5G02410.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02410  TAIR      NCBI 
Gene model AT5G02410.1  
Description DIE2/ALG10 family; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1, 2 glucosyltransferase Alg10 (InterPro:IPR016900), Glycosyltransferase, ALG10 (InterPro:IPR007006); Has 269 Blast hits to 222 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 131; Plants - 14; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 520634-519435)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G02410.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02410.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-519756-122

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTC-519766519775-132-141
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAAGCCCAACA-519837519849-203-215
 AtREG549TAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574    AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543     GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGTTGGGCTTTA-519851519860-217-226
 AtREG407TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376 TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365  GGGCTTTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.