version
PlantPromoterDB promoter information of AT5G02500.2

Summary of Gene (AT5G02500.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02500  TAIR      NCBI 
Gene model AT5G02500.2  
Description encodes a member of heat shock protein 70 family.  
#
#

Overview

Focused view (chromosome 5: 557334-556135)

Genome position     
from initiation codon
AT5G02500.1         
TSS from cDNA
TSS information
AT5G02500.2                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02500.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA722-556438-104

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-556569-235
TSS cloneCclone-556441-107
TSS cloneTclone-556440-106
TSS cloneTclone-556439-105
TSS cloneAclone-556438-104
TSS cloneCclone-556437-103
TSS cloneCclone-556436-102
TSS cloneAclone-556435-101
TSS cloneAclone-556434-100
TSS cloneAclone-556431-97
TSS cloneCclone-556430-96
TSS cloneAclone-556429-95
TSS cloneTclone-556423-89
TSS cloneTclone-556412-78

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTCTATATAAAGA-556462556475-128-141
Y PatchCGTCTTCTTC-556401556410-67-76
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTCCGA-556500556507-166-173
 AtREG594CCGTCCGA PPDB Motif  PLACE Motif 
REGACGTGTAC-556602556609-268-275
 AtREG562ACGTGTACABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCACGTGGAA-556685556693-351-359
 AtREG408CACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG627 ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.