version
PlantPromoterDB promoter information of AT5G02680.1

Summary of Gene (AT5G02680.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02680  TAIR      NCBI 
Gene model AT5G02680.1  
Description ATP binding / aminoacyl-tRNA ligase/ nucleotide binding; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT1G10310.1); Has 160 Blast hits to 160 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 90; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 604712-605911)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G02680.1                      5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02680.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+604939-773

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCT+604894604901-818-811
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGTTGGAT+604660604670-1052-1042
 AtREG553GACCGTTG   Auxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG554  CCGTTGGA  PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG586   CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGTTGACTTT+604735604742-977-970
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGGACCGTTGGAT+604871604881-841-831
 AtREG553GACCGTTG   Auxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG554  CCGTTGGA  PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG586   CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.