version
PlantPromoterDB promoter information of AT5G02810

Summary of Gene (AT5G02810)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02810  TAIR      NCBI 
Gene model AT5G02810  
Description PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels.  
#
#

Overview

Focused view (chromosome 5: 642461-641262)

Genome position     
from initiation codon
AT5G02810.1         
AT5G02815           
AT5G02815.1         
TSS from cDNA
TSS information
AT5G02810                        5'->3' (-)
Promoter sequence



 
AT5G02811.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02810

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-641977-516

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-641977-516
TSS cloneGclone-641976-515
TSS cloneTclone-641975-514

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGACGTGGAA-642106642116-645-655
 AtREG440CTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG627   ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGATCCACGTCAC-642153642163-692-702
 AtREG547ATCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG466   CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTACACGTGTCA-642223642233-762-772
 AtREG453TACACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG366  CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG389   ACGTGTCAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.