version
PlantPromoterDB promoter information of AT5G02830.1

Summary of Gene (AT5G02830.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G02830  TAIR      NCBI 
Gene model AT5G02830.1  
Description pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G18940.1); Has 14432 Blast hits to 5047 proteins in 162 species: Archae - 3; Bacteria - 24; Metazoa - 323; Fungi - 205; Plants - 13092; Viruses - 0; Other Eukaryotes - 785 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 649421-648222)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G02830.1                      5'->3' (-)
Promoter sequence



 
AT5G02840.1         
AT5G02840.2         
AT5G02840.3         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G02830.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-648453-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATACCGG-648569648576-148-155
 AtREG629TATACCGG PPDB Motif  PLACE Motif 
REGTCGGTTTAT-648578648586-157-165
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598 CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAATGACG-648715648722-294-301
 AtREG657AAATGACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG17+648706AT5G02840.1, AT5G02840.2, AT5G02840.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+648681AT5G02840.1, AT5G02840.2, AT5G02840.3
TSS cloneGclone+648704AT5G02840.1, AT5G02840.2, AT5G02840.3
TSS cloneGclone+648706AT5G02840.1, AT5G02840.2, AT5G02840.3
TSS cloneGclone+648707AT5G02840.1, AT5G02840.2, AT5G02840.3
TSS cloneTclone+648711AT5G02840.1, AT5G02840.2, AT5G02840.3
TSS cloneTclone+648714AT5G02840.1, AT5G02840.2, AT5G02840.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTCTCTCT+648720648730AT5G02840.1, AT5G02840.2, AT5G02840.3
Y PatchCCTTCTCTCTTC+648735648746AT5G02840.1, AT5G02840.2, AT5G02840.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGGTATA+648569648576AT5G02840.1, AT5G02840.2, AT5G02840.3
 AtREG629CCGGTATA PPDB Motif  PLACE Motif 
REGATAAACCGA+648578648586AT5G02840.1, AT5G02840.2, AT5G02840.3
 AtREG598ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.