version
PlantPromoterDB promoter information of AT5G03560.2

Summary of Gene (AT5G03560.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G03560  TAIR      NCBI 
Gene model AT5G03560.2  
Description nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2).  
#
#

Overview

Focused view (chromosome 5: 903719-902520)

Genome position     
from initiation codon
AT5G03560.1         
TSS from cDNA
TSS information
AT5G03560.2                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G03560.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-902741-22
TSS clone peakCclone-902734-15
TSS cloneTclone-902731-12

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCCC-902732902740-13-21
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGCGTAAACGGCGCGT-902796902814-77-95
 AtREG633AAACGCGT            PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG613       TAAACGGC     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524        AAACGGCG    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG538           CGGCGCGT PPDB MotifACGCGC  PLACE Motif 
REGAAAACGGCA-902824902832-105-113
 AtREG531AAAACGGC  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAACGGCACG-902853902863-134-144
 AtREG613TAAACGGC    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG522   ACGGCACG PPDB Motif  PLACE Motif 
REGGACCCGAA-902867902874-148-155
 AtREG597GACCCGAA PPDB MotifGGGACCC  PLACE Motif 
REGTATATGGGCCGAA-902878902890-159-171
 AtREG620TATATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364  TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380   ATGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393    TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427     GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGGCTA-902893902903-174-184
 AtREG443TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATCCACGT-902917902924-198-205
 AtREG547ATCCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCTAATGGG-902973902980-254-261
 AtREG558CTAATGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13+903708AT5G03570.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAACGACGA+903577903586AT5G03570.1
 AtREG565TAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG648  AACGACGA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.