version
PlantPromoterDB promoter information of AT5G03770

Summary of Gene (AT5G03770)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G03770  TAIR      NCBI 
Gene model AT5G03770  
Description 3-deoxy-D-manno-octulosonic acid transferase-related; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 3832 Blast hits to 3832 proteins in 736 species: Archae - 0; Bacteria - 1449; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 2371 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 994191-995390)

Genome position     
from initiation codon
AT5G03770.1         
TSS from cDNA
TSS information
AT5G03770                        5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G03770

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+995160-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGTCGTT+995035995042-156-149
 AtREG648TCGTCGTT PPDB Motif  PLACE Motif 
REGAGTTGGGCCATA+995048995059-143-132
 AtREG607AGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG449 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437   TGGGCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479    GGGCCATA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTATTGGGCTCA+995068995079-123-112
 AtREG417TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533   TTGGGCTC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG485    TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTAATGGGCTTAAGGCC+995087995103-104-88
 AtREG396TTAATGGG          PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC         PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG416         TTAAGGCC PPDB Motif  PLACE Motif 
REGAAAACGGC+995111995118-80-73
 AtREG531AAAACGGC PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.