version
PlantPromoterDB promoter information of AT5G03820.1

Summary of Gene (AT5G03820.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G03820  TAIR      NCBI 
Gene model AT5G03820.1  
Description GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, lipase activity, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Lipase, GDSL, active site (InterPro:IPR008265), Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: carboxylesterase/ hydrolase, acting on ester bonds / lipase (TAIR:AT5G03810.1); Has 1896 Blast hits to 1881 proteins in 197 species: Archae - 0; Bacteria - 297; Metazoa - 1; Fungi - 19; Plants - 1555; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1018251-1017052)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G03820.1                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G03820.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTCCGGTTCAGGCCCCAATTGGG+10182171018240AT5G03830.1
 AtREG644TTTCCGGT                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480   CCGGTTCA              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG374        TCAGGCCC         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG647              CCCAATTGGG PPDB Motif  PLACE Motif 
REGAGTGGGCTTTG+10182441018254AT5G03830.1
 AtREG510AGTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 GTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376  TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559   GGGCTTTG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.