version
PlantPromoterDB promoter information of AT5G03830.1

Summary of Gene (AT5G03830.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G03830  TAIR      NCBI 
Gene model AT5G03830.1  
Description FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1018516-1019715)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G03830.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G03830.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+1018398-268

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+1018370-296

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCTC+10183761018383-290-283
Y PatchTTCTCTCTT+10184061018414-260-252
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGTTCAGGCCCCAATTGGG+10182171018240-449-426
 AtREG644TTTCCGGT                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480   CCGGTTCA              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG374        TCAGGCCC         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG647              CCCAATTGGG PPDB Motif  PLACE Motif 
REGAGTGGGCTTTG+10182441018254-422-412
 AtREG510AGTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 GTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376  TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559   GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGCCGAACCGA+10182901018298-376-368
 AtREG456CCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575 CGAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTT+10183481018355-318-311
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.