version
PlantPromoterDB promoter information of AT5G04130.2

Summary of Gene (AT5G04130.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G04130  TAIR      NCBI 
Gene model AT5G04130.2  
Description DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1129031-1127832)

Genome position     
from initiation codon
AT5G04130.1         
TSS from cDNA
TSS information
AT5G04130.2                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G04130.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-1128091-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-1128091-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGGCG-11282211128228-190-197
 AtREG524AAACGGCG PPDB MotifAAACG(C/G)  PLACE Motif 
REGTGTTGGGCTTTG-11282301128241-199-210
 AtREG543TGTTGGGC     PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT    PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559    GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGATAAGCCCATAT-11282581128269-227-238
 AtREG462ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477   AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTTTTA-11282741128286-243-255
 AtREG421ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549     GGCTTTTA PPDB Motif  PLACE Motif 
REGCTATTGGGCT-11283011128310-270-279
 AtREG624CTATTGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.