version
PlantPromoterDB promoter information of AT5G05210.1

Summary of Gene (AT5G05210.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G05210  TAIR      NCBI 
Gene model AT5G05210.1  
Description nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1547198-1548397)

Genome position     
from initiation codon
AT5G05210.2         
TSS from cDNA
TSS information
AT5G05210.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G05210.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+1547440-758
TSS peakG2+1547442-756

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+1547442-756
TSS cloneGclone+1547443-755

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC+15474581547465-740-733
Y PatchTTTCTTCTCTC+15474731547483-725-715
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAAACGC+15471411547148-1057-1050
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGATGCCACGTGGAA+15472171547229-981-969
 AtREG448ATGCCACG     ABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG408    CACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG627     ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTTTCCGGTTAA+15472991547309-899-889
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621  TCCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501   CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCCCATTAAACCGAACCG+15473221547338-876-860
 AtREG396CCCATTAA          PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG473    TTAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514     TAAACCGA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568      AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556       AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451        ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG456         CCGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAACGCGGTT+15473681547377-830-821
 AtREG488TAACGCGG  SA PPDB Motif  PLACE Motif 
 AtREG441  ACGCGGTTDrought PPDB Motif  PLACE Motif 
REGAAATACCCTTA+15473841547394-814-804
 AtREG602AAATACCC    PPDB Motif  PLACE Motif 
 AtREG567 AATACCCT   PPDB MotifACCCT  PLACE Motif 
 AtREG623  ATACCCTT  PPDB MotifACCCT  PLACE Motif 
 AtREG570   TACCCTTA PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTCCACGTGGCAT-15472171547229AT5G05200.1
 AtREG627TTCCACGT      PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG367   CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379    ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG448     CGTGGCATABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
REGTTAACCGGAAA-15472991547309AT5G05200.1
 AtREG501TTAACCGG    PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534  AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTCGGTTTAATGGG-15473221547338AT5G05200.1
 AtREG456CGGTTCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 GGTTCGGT         PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514    TCGGTTTA      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473     CGGTTTAA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG396         TTAATGGG PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGAACCGCGTTA-15473681547377AT5G05200.1
 AtREG441AACCGCGT  Drought PPDB Motif  PLACE Motif 
 AtREG488  CCGCGTTASA PPDB Motif  PLACE Motif 
REGTAAGGGTATTT-15473841547394AT5G05200.1
 AtREG570TAAGGGTA    PPDB MotifACCCT  PLACE Motif 
 AtREG623 AAGGGTAT   PPDB MotifACCCT  PLACE Motif 
 AtREG567  AGGGTATT  PPDB MotifACCCT  PLACE Motif 
 AtREG602   GGGTATTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.