version
PlantPromoterDB promoter information of AT5G05680

Summary of Gene (AT5G05680)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G05680  TAIR      NCBI 
Gene model AT5G05680  
Description nuclear pore complex protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; Has 361 Blast hits to 348 proteins in 84 species: Archae - 2; Bacteria - 20; Metazoa - 218; Fungi - 31; Plants - 27; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1697365-1698564)

Genome position     
from initiation codon
AT5G05680.1         
TSS from cDNA
TSS information
AT5G05680                        5'->3' (+)
Promoter sequence












 
AT5G05670.1         
AT5G05670.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G05680

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+1698270-95
TSS cloneCclone+1698274-91
TSS clone peakTclone+1698316-49
TSS cloneGclone+1698356-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTCTTCC+16982851698295-80-70
Y PatchTCTCCTTC+16983241698331-41-34
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAATGGGCCGAATAAAAGCCCATTAA+16982071698233-158-132
 AtREG361  AATGGGCC                  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380   ATGGGCCG                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393    TGGGCCGA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427     GGGCCGAA               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG549             TAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409              AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376               AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378                AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372                 AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357 TAATGGGC         GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396TTAATGGG           CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGGTCGTTTC+16982471698254-118-111
 AtREG576GTCGTTTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2-1698128AT5G05670.2, AT5G05670.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-1698127AT5G05670.2, AT5G05670.1
TSS cloneCclone-1698124AT5G05670.2, AT5G05670.1
TSS cloneAclone-1698104AT5G05670.2, AT5G05670.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATATAAAAT-16981511698162AT5G05670.1, AT5G05670.2
Y PatchCGTCTTCC-16980831698090AT5G05670.1, AT5G05670.2
Y PatchTTCTTCTCC-16981111698119AT5G05670.1, AT5G05670.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAATGGGCTTTTATTCGGCCCATTAA-16982071698233AT5G05670.1, AT5G05670.2
 AtREG372  AATGGGCT                  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT               PPDB MotifGCCCA  PLACE Motif 
 AtREG549      GGCTTTTA              PPDB Motif  PLACE Motif 
 AtREG427              TTCGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393               TCGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380                CGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361                 GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357 TAATGGGC         GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396TTAATGGG           CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGGAAACGAC-16982471698254AT5G05670.1, AT5G05670.2
 AtREG576GAAACGAC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.