version
PlantPromoterDB promoter information of AT5G06340.1

Summary of Gene (AT5G06340.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G06340  TAIR      NCBI 
Gene model AT5G06340.1  
Description ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 1935467-1936666)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G06340.1                      5'->3' (+)
Promoter sequence







 
AT5G06330.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G06340.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA74+1936406-61

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+1936366-101
TSS cloneAclone+1936403-64
TSS cloneAclone+1936406-61
TSS cloneCclone+1936407-60
TSS cloneCclone+1936421-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATTGGGCTTTTA+19361921936205-275-262
 AtREG600TAATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549      GGCTTTTA PPDB Motif  PLACE Motif 
REGGGCCTTTT+19362251936232-242-235
 AtREG459GGCCTTTT PPDB Motif  PLACE Motif 
REGAAATGGGCCCAATA+19362521936265-215-202
 AtREG386AAATGGGC       PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391  ATGGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392    GGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352     GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355      GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGTTTGACCC+19363041936311-163-156
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTAAGGGTA+19363501936357-117-110
 AtREG570TAAGGGTA PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-1935630AT5G06330.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTCTATATAAAGG-19356561935669AT5G06330.1
Y PatchCTTTCTCTCT-19356201935629AT5G06330.1
Y PatchCTTCTTCT-19356651935672AT5G06330.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.