version
PlantPromoterDB promoter information of AT5G07090.1

Summary of Gene (AT5G07090.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G07090  TAIR      NCBI 
Gene model AT5G07090.1  
Description 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2200010-2201209)

Genome position     
from initiation codon
AT5G07080.1         
TSS from cDNA
TSS information
AT5G07090.1                      5'->3' (+)
Promoter sequence
















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G07090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG23+2202389-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+2202382-28
TSS cloneTclone+2202384-26
TSS cloneCclone+2202385-25
TSS cloneAclone+2202386-24
TSS cloneGclone+2202387-23
TSS cloneAclone+2202395-15

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATATAATG+22023502202359-60-51
Y PatchCGTCTTCT+22024162202423613
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCCACGTCAGC+22021202202132-290-278
 AtREG508ACGCCACG      PPDB Motif  PLACE MotifGCCAC 
 AtREG371 CGCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC    PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419   CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG440    CACGTCAG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG515     ACGTCAGCSA PPDB MotifACGT  PLACE MotifACGT 
REGATAAGGCC+22022292202236-181-174
 AtREG425ATAAGGCC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAGTTGGGCCTAAA+22022522202264-158-146
 AtREG607AGTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG449 GTTGGGCC     PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430     GGCCTAAA PPDB Motif  PLACE Motif 
REGAAATGGGCCTAT+22022802202291-130-119
 AtREG386AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGATAAGCCCAATAA+22022962202308-114-102
 AtREG462ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone+2200335AT5G07080.1
TSS clone peakAclone+2200351AT5G07080.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATATATATATATATATATCT+22002952200317AT5G07080.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGACTTT+22002062200213AT5G07080.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.