version
PlantPromoterDB promoter information of AT5G07890.2

Summary of Gene (AT5G07890.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G07890  TAIR      NCBI 
Gene model AT5G07890.2  
Description myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2520049-2518850)

Genome position     
from initiation codon
AT5G07890.1         
AT5G07890.3         
TSS from cDNA
TSS information
AT5G07890.2                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G07890.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-2520020-971
TSS peakA8-2519475-426

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2520041-992
TSS cloneTclone-2520040-991
TSS cloneTclone-2520038-989

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGTT-25200782520085-1029-1036
 AtREG516ACCGGGTT PPDB Motif  PLACE Motif 
REGTTTGACCCGAACCGACCCGACC-25200932520114-1044-1065
 AtREG592TTTGACCC               PPDB Motif  PLACE MotifTTGAC, TTGACC 
 AtREG617  TGACCCGA             PPDB Motif  PLACE Motif 
 AtREG597   GACCCGAA            PPDB MotifGGGACCC  PLACE Motif 
 AtREG456      CCGAACCG         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575       CGAACCGA        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG375           CCGACCCG    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383            CGACCCGA   PPDB Motif  PLACE Motif 
 AtREG390             GACCCGAC  PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405              ACCCGACC PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAAGCCCA+25198932519900AT5G07900.1
 AtREG525CAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.