version
PlantPromoterDB promoter information of AT5G07890.3

Summary of Gene (AT5G07890.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G07890  TAIR      NCBI 
Gene model AT5G07890.3  
Description myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2520493-2519294)

Genome position     
from initiation codon
AT5G07890.1         
AT5G07890.2         
TSS from cDNA
TSS information
AT5G07890.3                      5'->3' (-)
Promoter sequence









 
AT5G07900.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G07890.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-2520020-527

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-2520041-548
TSS cloneTclone-2520040-547
TSS cloneTclone-2520038-545

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGTT-25200782520085-585-592
 AtREG516ACCGGGTT PPDB Motif  PLACE Motif 
REGTTTGACCCGAACCGACCCGACC-25200932520114-600-621
 AtREG592TTTGACCC               PPDB Motif  PLACE MotifTTGAC, TTGACC 
 AtREG617  TGACCCGA             PPDB Motif  PLACE Motif 
 AtREG597   GACCCGAA            PPDB MotifGGGACCC  PLACE Motif 
 AtREG456      CCGAACCG         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575       CGAACCGA        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG375           CCGACCCG    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383            CGACCCGA   PPDB Motif  PLACE Motif 
 AtREG390             GACCCGAC  PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405              ACCCGACC PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-2519475AT5G07890.2
TSS peakA4+2520169AT5G07900.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+2520167AT5G07900.1
TSS cloneAclone+2520169AT5G07900.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCTCTCT+25201752520183AT5G07900.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAAGCCCA+25198932519900AT5G07900.1
 AtREG525CAAGCCCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAACCCGGT+25200782520085AT5G07900.1
 AtREG516AACCCGGT PPDB Motif  PLACE Motif 
REGGGTCGGGTCGGTTCGGGTCAAA+25200932520114AT5G07900.1
 AtREG405GGTCGGGT               PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG390 GTCGGGTC              PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG383  TCGGGTCG             PPDB Motif  PLACE Motif 
 AtREG375   CGGGTCGG            PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG575       TCGGTTCG        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456        CGGTTCGG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG597           TTCGGGTC    PPDB MotifGGGACCC  PLACE Motif 
 AtREG617            TCGGGTCA   PPDB Motif  PLACE Motif 
 AtREG592              GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.