version
PlantPromoterDB promoter information of AT5G08190.2

Summary of Gene (AT5G08190.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G08190  TAIR      NCBI 
Gene model AT5G08190.2  
Description NUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 2635204-2636403)

Genome position     
from initiation codon
AT5G08190.1         
TSS from cDNA
TSS information
AT5G08190.2                      5'->3' (+)
Promoter sequence






 
AT5G08185.1         
AT5G08185.2         
AT5G08185.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G08190.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+2635959-245

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGCTGA+26357562635763-448-441
 AtREG609TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAAAGCCCATTT+26358112635823-393-381
 AtREG589AAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386     GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGACGCGCCG+26358572635864-347-340
 AtREG538ACGCGCCG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5-2635439AT5G08185.1, AT5G08185.2, AT5G08185.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-2635436AT5G08185.1, AT5G08185.2, AT5G08185.3
TSS cloneGclone-2635386AT5G08185.1, AT5G08185.2, AT5G08185.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTTATAAATA-26354632635472AT5G08185.1, AT5G08185.2, AT5G08185.3
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.