version
PlantPromoterDB promoter information of AT5G08280.1

Summary of Gene (AT5G08280.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G08280  TAIR      NCBI 
Gene model AT5G08280.1  
Description Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast.  
#
#

Overview

Focused view (chromosome 5: 2666596-2665397)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G08280.1                      5'->3' (-)
Promoter sequence





 
AT5G08290.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G08280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA28-2665719-123

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-2665726-130
TSS cloneTclone-2665707-111
TSS cloneAclone-2665705-109
TSS cloneGclone-2665695-99
TSS cloneTclone-2665683-87
TSS cloneCclone-2665619-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTTC-26656702665678-74-82
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGGCCCAATAA-26658582665869-262-273
 AtREG457CCGGCCCA    CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414 CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355   GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCTAAGCCC-26658872665901-291-305
 AtREG474GTTTGGGC        PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571   TGGGCTAA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634       CTAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGAA-26659132665920-317-324
 AtREG631CGCGTGAADrought PPDB Motif  PLACE Motif 
REGCGGCGCGT-26659292665936-333-340
 AtREG538CGGCGCGT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG68+2666000AT5G08290.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+2665978AT5G08290.1
TSS cloneAclone+2665979AT5G08290.1
TSS cloneGclone+2665995AT5G08290.1
TSS cloneAclone+2665996AT5G08290.1
TSS cloneAclone+2666001AT5G08290.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATAAAAT+26659622665971AT5G08290.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTATTGGGCCGG+26658582665869AT5G08290.1
 AtREG417TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414   TTGGGCCG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457    TGGGCCGGCK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGGGCTTAGCCCAAAC+26658872665901AT5G08290.1
 AtREG634GGGCTTAG        PPDB MotifGCCCA  PLACE Motif 
 AtREG571    TTAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469      AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG474       GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTTCACGCG+26659132665920AT5G08290.1
 AtREG631TTCACGCGDrought PPDB Motif  PLACE Motif 
REGACGCGCCG+26659292665936AT5G08290.1
 AtREG538ACGCGCCG PPDB MotifACGCGC  PLACE Motif 
REGTAGGGCTT+26665522666559AT5G08300.1
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.